DNA Structure and Function: A Comprehensive Guide
DNA (DNA) Concept:
Chemically are polynucleotides consisting of d-AMP, d-GMP, d-CMP and d-TMP. The nucleotides of DNA have neither uracil nor ribose, as mentioned above.
Features:
The cellular DNA have a high molecular mass, many millions of daltons. For example: the human genome consists of pairs of nucleotides 3×109. This makes them a very long molecules, for example, 1.7 ?M in the case of poliovirus and 2.36 m if we add up all the DNA of all chromosomes in a human cell. DNA was first isolated in 1869, but until 1950 did not begin to know their structure.
It is located in the nucleus of eukaryotic cells associated proteins (histones and other) to form chromatin, the substance that constitutes the chromosomes and from which genetic information is transcribed. There is also DNA in certain cell organelles (eg plastids and mitochondria).
STRUCTURE OF DNA can distinguish 3 structural levels: – Primary Structure:
The sequence of nucleotides .- Secondary structure: the double helix .- Tertiary Structure: pearl necklace, crystal structure, DNA supercoiling. In eukaryotic cells, from the 3rd structure, there are other levels of higher-order packing.
Primary structure of DNA
The nucleotide sequence is a string or thread. That is, the primary structure of DNA is determined by the order of nucleotides in the thread or chain of the molecule. To indicate the sequence of a DNA chain is enough with the names of the bases or initial (A, T, C, G) in the right order and the 5 ‘and 3’ nucleotide chain. For example: 5’ACGTTTAACGACAAGTATTAAGACAAGTATTAA3 ‘The possibility of combining four different nucleotides and the great lengths that can be polynucleotide chains, means that there may be a large number of polynucleotides possible, which determines that the message may contain DNA or biological genetic information and explains the diversity of the genetic message of all living things according to the model of the double helixWatson and Crick
1) DNA would consist of two chains or strands of polynucleotides in right-handed helically wound on a single axis to form a double helix. 2 º) Both chains would be antiparallel, one would be 3’ð5 sense ‘and the other in reverse, 5’ð3’. 3rd) The phosphate groups would be outward and thus their negative charges interaccionarían with cations present in the nucleoplasm giving more stability to the molécula.4 º) The nitrogenous bases would be toward the inside of the helix with their planes parallel and the bases of each of the propellers would be paired with the other partners through hydrogen bonds. 5th)
The mating would take place only between adenine and thymineOne hand, and guanine and cytosine, on the other. Therefore, the primary structure of a chain would be determined by the other, both strands would be complementary. The complementarity of the chains suggests the mechanism by which DNA is replicated back-to-be transferred to daughter cells. Both chains or strands can be separated partially and serve as a template for the synthesis of a new complementary strand (semiconservative synthesis).
PROPERTIES OF THE SECONDARY STRUCTURE OF DNA: denaturation
If a solution is heated sufficiently DNA both strands are separated, as they break hydrogen bonds linking the bases, and DNA is denatured. The denaturation temperature depends on the proportion of bases. A greater proportion of CG, the higher denaturation temperature, since cytosine and guanine establish three hydrogen bonds, while adenine and thymine only two and, therefore, a greater proportion of CG, the more hydrogen bonds joining the two chains. The distortion is also produced by changing the pH or high salt concentrations. If conditions are restored, DNA and both strands were renatured reunited again.
Tertiary structure of DNA in eukaryotic cells
The large DNA molecules of eukaryotic cells are closely packed and occupy less space in the cell nucleus and also as a mechanism to preserve its transcription. As seen in eukaryotic DNA in the nucleus is associated with certain proteins: nucleoprotein, forming chromatin.
In chromatin, the DNA double helix wraps around a globular protein molecules, histones, forming nucleosomes.
Each nucleosome contains 8 histones and the DNA double helix makes two turns around (200 pairs). The complex, if not even more packed, forming a structure called the beaded necklace.
However, nucleosomes can be packaged to form fibers of a thickness of 30 nm (30 nm fiber).
According to the model of the solenoid fibers are formed by six nucleosomes per turn rolled around an axis formed by the histone H1. TYPES OF DNA structure differ according to the following types of DNA – single-stranded or a string, for example those of some viruses .- double stranded, with two strands or chains (all other viruses, bacteria and eukaryotes). In turn, and in both cases, DNA can be: – Linear, such as the nucleus of eukaryotic cells and some viruses – Circular, such as mitochondria, chloroplasts, bacteria and viruses.